A practical reference on alpha-MSH analog: what it is, how it behaves, what the literature reports, and where the honest uncertainties sit.
This page was last updated on 2026-02-22 and is reviewed periodically as new material appears.
Melanotan II binds several melanocortin receptor subtypes rather than a single target. MC1R on melanocytes drives melanin synthesis, while MC3R and MC4R participate in energy balance, appetite, and sexual response pathways. This lack of selectivity explains why reported effects extend beyond skin darkening. Substitutions at positions four and seven, including norleucine and D-phenylalanine, increase potency and resistance to peptidases. Understanding which receptor mediates which effect remains an active area of investigation.
Published human data come mostly from small, short studies rather than large controlled trials. Reported outcomes include increased skin pigmentation and, in some reports, effects on appetite and libido, but sample sizes are small and follow-up is limited. Whether long-term use produces durable pigment changes or adverse effects is not established. Because products sold outside pharmacies are not standardized, the actual content of any given vial is often unknown. Independent testing of such material is uncommon.
Melanotan II is a synthetic cyclic heptapeptide analog derived from the core sequence of alpha-melanocyte-stimulating hormone. Researchers at the University of Arizona synthesized it during the 1980s while studying pigmentation and appetite signaling. The compound is not an approved medicine in any major jurisdiction and appears mainly in laboratory and research-chemical settings. Its structure incorporates a lactam bridge between side chains, which constrains the ring and slows enzymatic breakdown relative to the natural hormone.
Melanotan-2 appears on the World Anti-Doping Agency prohibited list within the peptide hormone class, and several national regulators treat it as an unapproved prescription substance. Some countries restrict importation or sale for personal use. Because the compound is widely traded as a research chemical, the practical legal picture differs between jurisdictions and shifts over time. Human safety data covering long periods are limited, and whether repeated pigmentation changes carry any lasting risk to melanocytes remains an open question.
Freeze-dried melanotan-2 is normally kept as a desiccated powder at minus twenty degrees Celsius or lower, shielded from light and moisture. Peptides of this size degrade through hydrolysis, oxidation and deamidation, and each pathway accelerates as temperature and water activity rise. Repeated freeze-thaw cycles promote aggregation and loss of material, so aliquoting a stock solution before freezing is standard laboratory practice. Once dissolved, the solution is markedly less stable than the powder. In laboratory work, solutions are generally refrigerated and used within days rather than kept for months.
Identity and purity are usually assessed by reversed-phase high-performance liquid chromatography, which separates the target peptide from truncated or oxidised impurities. Mass spectrometry, most often coupled to liquid chromatography, confirms molecular mass and detects substitutions that chromatography alone may miss. Amino acid analysis and peptide mapping supply additional structural evidence, while nuclear magnetic resonance is reserved for full structural confirmation. Laboratories that examine samples sold online report wide variation in actual content, with some vials containing little or none of the labelled material.
| Property | Value | Notes |
|---|---|---|
| Chemical class | Synthetic cyclic heptapeptide | Analog of alpha-melanocyte-stimulating hormone |
| Primary receptor family | Melanocortin receptors MC1R through MC5R | Binding is not subtype-selective |
| Development period | 1980s | Synthesized during pigmentation and appetite research |
| Regulatory status | Not an approved medicine | No major regulator has authorized human use |
| Related compound | Afamelanotide | Linear analog studied for photoprotection |
Receptor-binding studies classify melanotan II as a non-selective melanocortin agonist. It interacts with MC1R, MC3R, MC4R and MC5R, with reported affinities in the low nanomolar range and no strong subtype preference. Activation of MC1R on dermal melanocytes shifts pigment synthesis toward eumelanin, the dark polymer deposited in melanosomes and transferred to keratinocytes. Because the same peptide engages MC4R in the hypothalamus, it also appears in animal work on food intake and erectile response, which is why it is discussed in both pigment and metabolic research. Which receptor populations dominate after systemic exposure in humans is not fully established.
Published pharmacokinetic information is limited and comes mainly from small studies rather than registrational trials. Plasma half-life is usually described as short, on the order of tens of minutes, followed by rapid tissue distribution and clearance of the intact peptide. Metabolites and low concentrations of parent compound have been reported in urine, a detail relevant to anti-doping and forensic testing. Whether repeated exposure changes receptor sensitivity or clearance over time remains an open question. Values differ noticeably between analytical assays, so published numbers should be read as approximate rather than definitive.
Lyophilised melanotan-2 is supplied as a solid, which is more stable than a solution. The material is hygroscopic, so weighing is done quickly, in low humidity, with the container kept sealed. Reconstitution usually uses water for injection or bacteriostatic water, added down the wall of the vial to limit foaming. A reconstituted solution is held at 2 to 8 °C and kept away from light. Repeated freezing and thawing of the same vial is avoided because ice crystal formation and concentration effects degrade the peptide.
Reversed-phase high-performance liquid chromatography is the routine method for purity assessment. Peptides absorb near 214 nm because of the peptide bond, and a gradient of acetonitrile in water separates the intact peptide from deletion sequences, oxidised products, and earlier-eluting fragments at neutral pH. Electrospray ionisation mass spectrometry provides an orthogonal check: the measured mass must agree with the theoretical value. Amino acid analysis and peptide mapping confirm structure but are used less often. Reference standards remain scarce because the peptide is not described in any pharmacopoeia.
Melanotan-2 is a synthetic cyclic heptapeptide designed as an analogue of alpha-melanocyte-stimulating hormone, a naturally occurring peptide involved in pigmentation signalling. Its sequence incorporates modified residues that increase potency and extend biological activity relative to the native hormone. The compound binds receptors of the melanocortin family and is examined mainly in laboratory research. It does not occur naturally and exists only as a manufactured chemical entity produced by solid-phase synthesis.
The peptide was developed during the 1980s by researchers investigating melanocortin signalling and skin pigmentation pathways. Early work focused on analogues of alpha-melanocyte-stimulating hormone that would resist enzymatic breakdown more effectively than the parent molecule. Melanotan-2 emerged from that programme as a shortened, cyclised variant. Reports describing its synthesis and receptor activity later appeared in the scientific literature. Commercial availability grew through unregulated channels rather than through pharmaceutical approval.
Structurally, Melanotan-2 retains the core recognition motif of alpha-melanocyte-stimulating hormone while adding a lactam bridge that links two side chains and constrains the molecule into a ring. This modification lowers susceptibility to enzymatic degradation. The compound acts as an agonist at melanocortin receptors, particularly subtypes associated with melanin production. Because the same receptor family influences several physiological processes, researchers note that its activity is not confined to pigmentation alone. Receptor selectivity continues to be examined in published studies.
Lefse (Norwegian pronunciation: [ˈlɛ́fsə̌], cognate to loaf), dialectally also lefsa (among others), is a traditional soft Norwegian flatbread, also found regionally in Sweden (Swedish: läfsa, löfsa). It is made with riced potatoes, can include all purpose (wheat) flour, and includes butter, and milk, cream, or lard. It is cooked on a large, flat griddle. Special tools are used to prepare lefse, including a potato ricer, long wooden turning sticks and special rolling pins with deep grooves.
==== Rwanda ==== Zipline operates two distribution centers in Rwanda. Zipline began deliveries at its first distribution center in Muhanga in October 2016. In 2018, the Rwandan government signed a new deal to build a second distribution center near Kayonza, in the eastern part of the country. This deal expanded Zipline's service to include smaller health centers and hospitals and deliver vaccines and other medical products and blood products. Zipline opened the Kayonza distribution center in December 2018. The company hoped this would bring coverage to 80 percent of the country. Rwanda has mountainous geography and poor road conditions, making an aerial delivery system more efficient than the use of land vehicles. The cost of delivery via drone is comparable to that of delivery by road, especially in emergencies. A 2022 study found that Zipline's service in Rwanda leads to faster delivery times relative to existing ground transportation and less blood component wastage in health facilities. The study found that Zipline's drone delivery service in Rwanda shortened blood product delivery times by 61 percent, reduced blood unit expirations by 67 percent, and was frequently used in response to medical emergencies, with 43 percent of orders being emergency orders.
== Post-natal functions of neohormones == After birth, neohormones play a major role in development of mammary glands and their function. Alongside, neohormones have also been measured to be a significant component of breast milk. The so-called lactocrine hypothesis dictates that breast milk does not simply fulfil nutritional requirements but also plays an important role in signaling and development in the neonate. Neohormones are theorised to have specific effects on target organs in the neonate, but more research is needed in this area, and effects have been observed to different extents in different species.
== Perfluoroaromatic compounds == Perfluoroaromatic compounds contain only carbon and fluorine, like other fluorocarbons, but also contain an aromatic ring. The three most important examples are hexafluorobenzene, octafluorotoluene, and octafluoronaphthalene.
{\displaystyle {\hat {H}}={\frac {{\hat {p}}_{x}^{2}+{\hat {p}}_{y}^{2}+{\hat {p}}_{z}^{2}}{2m}}+{\frac {\omega _{c}}{2}}({\hat {x}}{\hat {p}}_{y}-{\hat {y}}{\hat {p}}_{x})+{\frac {1}{2}}m\left({\frac {\omega _{1}}{2}}\right)^{2}({\hat {x}}^{2}+{\hat {y}}^{2})+{\frac {1}{2}}m\omega _{z}^{2}{\hat {z}}^{2}}
Sources: en.wikipedia.org
CTCCAACATCAAGGAAGATGGCATTTCTAG (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488), 30-mer, 20% G, 43% CG, Predicted Tm: 88.9 °C at 10 μM oligo. Oligo complement CTAGAAATGCCATCTTCCTTGATGTTGGAG DMD-001 Exon 51, ENST00000357033.8 in Ensembl.org, RNA target site marked. Given that the target site is within an exon, this is likely blocking binding of an exonic splice enhancer protein and so altering splicing by interfering with splice regulation. CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC GGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGA GGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG
==== 2023–24 UEFA Women's Nations League B ==== 23 September – Ireland 3–0 Northern Ireland. 26 September – Hungary 0–4 Ireland. 27 October – Ireland 5–1 Albania. 31 October – Albania 0–1 Ireland. 1 December – Ireland 1–0 Hungary. 5 December – Northern Ireland 1–6 Ireland.
In chemistry, silica gel is used in chromatography as a stationary phase. In column chromatography, the stationary phase is most often composed of silica gel particles of 40–63 μm. Different particle sizes are used for different kinds of column chromatography as the particle size is related to surface area. The differences in particle size dictate if the silica gel should be used for flash or gravity chromatography. In this application, due to silica gel's polarity, non-polar components tend to elute before more polar ones, hence the name normal phase chromatography. However, when hydrophobic groups (such as C18 groups) are attached to the silica gel then polar components elute first and the method is referred to as reverse phase chromatography. Silica gel is also applied to aluminium, glass, or plastic sheets for thin layer chromatography. The hydroxy (OH) groups on the surface of silica can be functionalized to afford specialty silica gels that exhibit unique stationary phase parameters. These so-called functionalized silica gels are also used in organic synthesis and purification as insoluble reagents and scavengers. Chelating groups have also been covalently bound to silica gel. These materials have the ability to remove metal ions selectively from aqueous solutions. Chelating groups can be covalently bound to polyamines that have been grafted onto a silica gel surface producing a material of greater mechanical integrity. Silica gel is also combined with alkali metals to form a M-SG reducing agent.
Radon is a naturally occurring radioactive noble gas discovered in 1900 by Friedrich Ernst Dorn (1848-1916) and is considered carcinogenic. Radon is increasingly found in areas with high levels of uranium and thorium in the soil. These are mainly areas with high granitic rock deposits. According to studies by the World Health Organization, the incidence of lung cancer increases significantly at radiation levels of 100-200 Bq per cubic meter of indoor air. The likelihood of developing lung cancer increases by 10% with each additional 100 Bq/m3 of indoor air.
Sources: en.wikipedia.org
==== Response and fallout ==== Although the experimental protocol had not been published, physicists in several countries attempted, and failed, to replicate the excess heat phenomenon. The first paper submitted to Nature reproducing excess heat, although it passed peer review, was rejected because most similar experiments were negative and there were no theories that could explain a positive result; this paper was later accepted for publication by the journal Fusion Technology. Nathan Lewis, professor of chemistry at the California Institute of Technology, led one of the most ambitious validation efforts, trying many variations on the experiment without success, while CERN physicist Douglas R. O. Morrison said that "essentially all" attempts in Western Europe had failed. Even those reporting success had difficulty reproducing Fleischmann and Pons' results. On 10 April 1989, a group at Texas A&M University published results of excess heat and later that day a group at the Georgia Institute of Technology announced neutron production—the strongest replication announced up to that point due to the detection of neutrons and the reputation of the lab. On 12 April Pons was acclaimed at an ACS meeting. But Georgia Tech retracted their announcement on 13 April, explaining that their neutron detectors gave false positives when exposed to heat. Another attempt at independent replication, headed by Robert Huggins at Stanford University, which also reported early success with a light water control, became the only scientific support for cold fusion in 26 April US Congress hearings.
=== Exhibitor response and claims of profitability === In contrast to the claims of distributor losses, several theatre owners and exhibitors publicly stated that Darbar performed profitably in their respective cinemas. According to The Times of India, multiple exhibitors across Tamil Nadu and other regions took to social media to refute reports describing the film as a loss-making venture.
== Treatment == In most of the reported cases, the treatment options were very similar. Plasmapheresis alone or in combination with steroids, sometimes also with thymectomy and azathioprine, have been the most frequently used therapeutic approach in treating Morvan's Syndrome. However, this does not always work, as failed response to steroids and to subsequently added plasmapheresis have been reported. Intravenous immunoglobulin was effective in one case. In one case, the dramatic response to high-dose oral prednisolone together with pulse methylprednisolone with almost complete disappearance of the symptoms within a short period should induce consideration of corticosteroids. In another case, the subject was treated with haloperidol (6 mg/day) with some improvement in the psychomotor agitation and hallucinations, but even high doses of carbamazepine given to the subject failed to improve the spontaneous muscle activity. Plasma Exchange (PE) was initiated, and after the third such session, the itching, sweating, mental disturbances, and complex nocturnal behavior improved and these symptoms completely disappeared after the sixth session, with improvement in insomnia and reduced muscle twitching. However, one month after the sixth PE session, there was a progressive worsening of insomnia and diurnal drowsiness, which promptly disappeared after another two PE sessions.
Sources: en.wikipedia.org
No regulator in a major market has approved it for human use. It appears in research settings and in products marketed outside pharmacy channels. Legal status for personal possession varies by country.
Afamelanotide is a linear analog that has received approval in some jurisdictions for a specific photoprotection indication. Melanotan II is cyclic and less selective across melanocortin receptors. The two are related but are not interchangeable in regulatory or clinical terms.
A compound that activates several receptor subtypes may produce effects beyond pigmentation. Selectivity influences which tissues respond and shapes the side-effect profile described in reports. Designing subtype-selective analogs is a stated goal of melanocortin research.
The lyophilised solid is best kept cold, dry and dark, typically at minus twenty degrees Celsius. Moisture and repeated warming cycles are the main causes of degradation. Solutions prepared from the powder are less stable and are normally used quickly.